What is a hash table?

A hash table (aka hash map) is a data structure which stores data as key-value pairs. The keys of a hash table are hashed to produce a unique value, which is then used to store the data in the table (thus, the keys of a hash table must be unique). This allows for very fast lookup and retrieval of the data, regardless of the size of the table.

What is a set?

A set (aka hash set) is a collection of unique elements. It is similar to a hash table, but only stores keys (no values).

Hash table example:

This is a hash table that uses strings as keys and stores an array of strings as values.

Key Values
animals rabbit, dog
fruits apple, watermelon, pineapple
continents Asia, Europe, Africa 
// Create a hashtable
Hashtable<String, String[]> hashTable = new Hashtable<String, String[]>();

// Add elements to the hashtable
String[] animals = {"rabbit", "dog"};
hashTable.put("animals", animals);

String[] fruits = {"apple", "watermelon", "pineapple"};
hashTable.put("fruits", fruits);

String[] continents = {"Asia", "Europe", "Africa"};
hashTable.put("continents", continents);

// Get a value from the hashtable given a key
hashTable.get("animals")[0]); // returns "rabbit"
hashTable.get("vegetables"); // returns null

// Check if a key exists in the hashtable
hashTable.containsKey("animals"); // returns true

// Check if a value exists in the hashtable
hashTable.contains(animals); // returns true

hashTable.isEmpty(); // returns false
hashTable.size(); // returns 3

Hash Map version:

Differences between Hashtable and HashMap (https://www.baeldung.com/hashmap-hashtable-differences).

// Create a HashMap
HashMap<String, String[]> HashMap = new HashMap<String, String[]>();

// Add elements to the HashMap
String[] animals = {"rabbit", "dog"};
HashMap.put("animals", animals);

String[] fruits = {"apple", "watermelon", "pineapple"};
HashMap.put("fruits", fruits);

String[] continents = {"Asia", "Europe", "Africa"};
HashMap.put("continents", continents);

// Get a value from the HashMap given a key
System.out.println(HashMap.get("animals")[0]); // returns "rabbit"
HashMap.get("vegetables"); // returns null

// Check if a key exists in the HashMap
HashMap.containsKey("animals"); // returns true

// Check if a value exists in the HashMap
HashMap.containsValue(animals); // returns true

HashMap.isEmpty(); // returns false
HashMap.size(); // returns 3

1) Count Number of Unique Elements in Array

Given an integer array, return the number of unique integers in the array.

Example 1:

Input: [1,2,3,2,1,2,2,1]
Output: 3

Example 2:

Input: [1,2,3,4,5]
Output: 5

2) Check if Number Has Equal Digit Count and Digit Value

You are given a 0-indexed string num of length n consisting of digits.

Return true if for every index i in the range 0 <= i < n, the digit i occurs num[i] times in num, otherwise return false.

Example 1:

Input: num = "1210"
Output: true
Explanation:
num[0] = '1'. The digit 0 occurs once in num.
num[1] = '2'. The digit 1 occurs twice in num.
num[2] = '1'. The digit 2 occurs once in num.
num[3] = '0'. The digit 3 occurs zero times in num.
The condition holds true for every index in "1210", so return true.

Example 2:

Input: num = "030"
Output: false
Explanation:
num[0] = '0'. The digit 0 should occur zero times, but actually occurs twice in num.
num[1] = '3'. The digit 1 should occur three times, but actually occurs zero times in num.
num[2] = '0'. The digit 2 occurs zero times in num.
The indices 0 and 1 both violate the condition, so return false.

Constraints:

  • n == num.length
  • 1 <= n <= 10
  • num consists of digits

3) Two Sum

Given an array of integers nums and an integer target, return indices of the two numbers such that they add up to target.

Example 1:

Input: nums = [2,7,11,15], target = 9
Output: [0,1]
Explanation:
Since nums[0] + nums[1] == 9, we return [0, 1].

Example 2:

Input: nums = [3,2,4], target = 6
Output: [1,2]
Explanation:
Since nums[1] + nums[2] == 6, we return [1, 2].

Example 3:

Input: nums = [3,3], target = 6
Output: [0,1]
Explanation:
Since nums[0] + nums[1] == 6, we return [0, 1].

4) Pairs of Songs With Total Durations Divisible by 60

You are given a list of songs where the ith song has a duration of time[i] seconds.

Return the number of pairs of songs for which their total duration in seconds is divisible by 60. Formally, we want the number of indices i, j such that i < j with (time[i] + time[j]) % 60 == 0.

Example 1:

Input: time = [30,20,150,100,40]
Output: 3
Explanation: Three pairs have a total duration divisible by 60:
(time[0] = 30, time[2] = 150): total duration 180
(time[1] = 20, time[3] = 100): total duration 120
(time[1] = 20, time[4] = 40): total duration 60

Example 2:

Input: time = [60,60,60]
Output: 3
Explanation: All three pairs have a total duration of 120, which is divisible by 60.

Constraints:

  • 1 <= time.length <= 6 * 10^4
  • 1 <= time[i] <= 500

5) Repeated DNA Sequences

The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'.

For example, "ACGAATTCCG" is a DNA sequence. When studying DNA, it is useful to identify repeated sequences within the DNA.

Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

Example 1:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC","CCCCCAAAAA"]

Example 2:

Input: s = "AAAAAAAAAAAAA"
Output: ["AAAAAAAAAA"]

Constraints:

  • 1 <= s.length <= 10^5
  • s[i] is either 'A', 'C', 'G', or 'T'.